Cortinarius thiersii Ammirati & A.H. Sm. (1977) *Collections: Calfiornia
![]() |
||
| This is the most frequently encountered
member of Dermocybe in Northern California, fruiting both autumnally and vernally. The vernal fruiting is
most commonly observed in Sierra Nevada, soon after snowmelt and it was named Cortinarius thiersii. Eventually, when the types were sequenced, it was realized that what
we call Cortinarius croceus in the fall is actually the same species. Genetically, it is in the
Cortinarius croceus group.
It is also an
extremely variable taxon that can masquerade under various disguises in
order to confuse identifiers. It tends to have less antraquinoid pigment
than Cortinarius
cinnamomeus and as a result has less orange/reddish hues
overall.
This is the ITS1/2 sequence: aaggatcattattgaaataaacctgatgggttgctgctggctctctagggagcatgtgcacacttgtcatctttatatctccacctgtgcaccttttgtagatctggatatctttctgaatgcctggcattcgggtttgaggattgacttttgtctttccttacatttccaggcctatgttttcttcatatacaccatttatgttatagaatgtaatgaaaagggcctttgtgcctacaaaccatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcattaatatatcaacctcctcaggttttaacttgtcgagtgtttggatgtgggggtcttttgctggtctcttttgaggtcggctcccctaaaatgcattagcggaacaatttgttgacccgttcattggtgtgataactatctacgcttttgacgtgaaacaggttcagcttctaacagtccattgacttggacaaatttt |
||
![]() |
||
![]() ![]() |
||
|
||
![]() ![]() |
||
![]() |
||
|