Cortinarius thiersii Ammirati & A.H. Sm. (1977)                                                  *Collections: Calfiornia

This is the most frequently encountered member of Dermocybe in Northern California, fruiting both autumnally and vernally. The vernal fruiting is most commonly observed in Sierra Nevada, soon after snowmelt and it was named Cortinarius thiersii. Eventually, when the types were sequenced, it was realized that what we call Cortinarius croceus in the fall is actually the same species. Genetically, it is in the Cortinarius croceus group. It is also an extremely variable taxon that can masquerade under various disguises in order to confuse identifiers. It tends to have less antraquinoid pigment than Cortinarius cinnamomeus and as a result has less orange/reddish hues overall.

This is the ITS1/2 sequence:

aaggatcattattgaaataaacctgatgggttgctgctggctctctagggagcatgtgcacacttgtcatctttatatctccacctgtgcaccttttgtagatctggatatctttctgaatgcctggcattcgggtttgaggattgacttttgtctttccttacatttccaggcctatgttttcttcatatacaccatttatgttatagaatgtaatgaaaagggcctttgtgcctacaaaccatatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcattaatatatcaacctcctcaggttttaacttgtcgagtgtttggatgtgggggtcttttgctggtctcttttgaggtcggctcccctaaaatgcattagcggaacaatttgttgacccgttcattggtgtgataactatctacgcttttgacgtgaaacaggttcagcttctaacagtccattgacttggacaaatttt


Vancouver, BC, Canada
Sierra Nevada (Spring)

Spores:6.4-8 (9) x 4.5-5(5.5)µ (weakly verrucose)
KOH 5%